HollyShip
HollyShip HollyShip
  • 03-05-2018
  • Mathematics
contestada

please answer and tell me how you did it

please answer and tell me how you did it class=

Respuesta :

Аноним Аноним
  • 03-05-2018
Since it's a rhombus, all the sides are equal.

[tex]x + 2 = 3x \\ 3x - x = 2 \\ 2x = 2 \\ x = 1[/tex]

Answer : x = 1

Hope this helps. - M
Answer Link
adabrackett678 adabrackett678
  • 03-05-2018
Create the equation 3x=x+2 since the sides are the same size. Then solve the equation you would move over the x and it would end up 3x-x=2. Then solve. you would get 2x=2. then divide 2x by 2 and you would get x=1
Answer Link

Otras preguntas

A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A vehicle is only 15% efficient. What happened to the other 85%?
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
How do you put allele in a sentence
p(x) x^3+x^2-x-1 Find all zeros of p (x)
How did the mountains in Greece contribute to the rise of city-states?
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
i need help with #3
What is the primary purpose of the Supremacy Clause?