stephaniecachop84gss stephaniecachop84gss

03-05-2018
World Languages

contestada

If you believed In the oscillating Universe theory, what would you say?

Respuesta :

MandiBurton MandiBurton

03-05-2018

If you believe in the oscillating Universe theory, like my crazy sister, then you would say, like her, that in the distant future we are all going to be crushed.

Answer Link

Otras preguntas

A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup

Write expression using the distributive property to find the product of 7 times 63

why did russia have revolution in 1917?

Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo

Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se

does a human body use neon???

HELPPPPP 35% OF GRADEEEEE.... When John bought his new computer, he purchased an online computer help service. The help service has a yearly fee of $25.50 and a

What is the additive inverse of -4a