homework89 homework89
  • 01-12-2017
  • English
contestada

Swish , ping , and zoom are examples of

Respuesta :

Аноним Аноним
  • 01-12-2017
They are onomatopoeia's. It's figurative language. Hope I helped. 
Answer Link
Аноним Аноним
  • 01-12-2017
Hello There!

They are examples of onomatopoeia. Onomatopoeia is writing sound effects.

Hope This Helps You!
Good Luck :) 

- Hannah ❤
Answer Link

Otras preguntas

What were the driving forces behind the industrial revolution
Which is one type of play that Shakespeare wrote? A. histories B. musicals C. passion plays D. burlesques Question Resources
How well did feudalism establish order in the Middle ages?
testosterone directly affects the
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
is a centimeter one tenth or one hundredth or a meter
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
how can you write 0.45 as fraction and a percentage ,please show work