nickhavi nickhavi
  • 02-03-2015
  • Mathematics
contestada

what is three fiths of 45

Respuesta :

apologiabiology
apologiabiology apologiabiology
  • 02-03-2015
'of' can be translated as multiply so
3/5 times 45/1=135/5=27

the number is 27
Answer Link

Otras preguntas

a trip to the ocean can be a relaxing escape from the everyday pressures of life. A Sailboat glistening on the horizon provides a mental escape to faraway place
Why might echinoderms make a more appropriate study species for making inferences about humans than other commonly studied species such as drosophila fruit flie
Which graph is a translation of f(x)=x^2, according to the rule: y=(x-2)^2
The number of degrees of freedom for a test cross of an ss/rr individual would be
WILL MARK THE BRAINIEST!!!!! A biologist just found a new organism living in the deep ocean and is unsure whether or not to classify it as an animal. Describe t
Find the product. (7x-2) (x+y)
(60) Points HeLp asap 5 questions
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
find the greatest common divisor of 9 and 27
Identify the specific sensory receptors for each of the five common senses.