PromiseA137396 PromiseA137396
  • 03-11-2022
  • Mathematics
contestada

which anwser shows the best approximation of [tex] \sqrt[]{26} [/tex]

which anwser shows the best approximation of tex sqrt26 tex class=

Respuesta :

AryaanY687348 AryaanY687348
  • 03-11-2022

Solution

[tex]\begin{gathered} \sqrt[]{26} \\ \text{simplifying }to\text{ decimal form} \\ =5.09901\ldots \end{gathered}[/tex]

Answer: the best approximation is 5.1

Answer Link

Otras preguntas

Vera attends piano lesson twice a week for 12 hours each. She practices at home 2 hours each week. How many hours does Vera play her piano each week?
Julie has just gotten back from her vacation to Paris. Instructions Change tous les verbes listés au passé composé. 1. Le premier jour, nous visité la tour Eiff
Which of the following describes how Nola is behaving?
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
in which part of the cell is the majority of the energy released from the breakdown of glucose
What is the slope of the graph shown below? ​
Write the equation in slope-intercept form. 13x + 10y = 4
HELP ME OUT PLEASE! You are trying to sell a new product to a store owner. Which method of presentation is likely the most effective? O a chart showing how sale
PHYSICS HELP PLS A car with mass 2400 kg and initial velocity 30.0 m/s brakes to a stop in 60.0 meters. What is the coefficient of friction between the tires an
Identify the domain of the function shown in the graph.