keylock43266 keylock43266
  • 02-05-2022
  • Mathematics
contestada

Twice a number y is more than
-2.5

Respuesta :

joshuawabankston2003 joshuawabankston2003
  • 02-05-2022

Answer:

2y >= 5/2

Step-by-step explanation:

Answer Link

Otras preguntas

The length of the shorter base in an isosceles trapezoid is 4 in, its altitude is 5 in, and the measure of one of its obtuse angles is 135°. Find the area of th
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What is the value of x? x = 2 x = 3 x = 4 x = 6
Which order pair could be removed so that the set of ordered pairs is a function (4,-2) (-3,2) (3,4) (1,1)
Everyone in the neighborhood has been complaining about the deteriorating condition of the park, but nobody has cleaned it up. why not
An element's atomic number is 64. How many protons would an atom of this element have?
Please help me with this
Which of these hormones does not help control fluid balance during exercise?
Describe these small intestine structures and their functions: intestinal glands -
How many grams of potassium hydroxide are needed to prepare 600 ml of a.450 m koh solution?