lealFr5i3ercysuzykm lealFr5i3ercysuzykm
  • 03-01-2017
  • Mathematics
contestada

Math help please? There are 12 more toy cars than toy trucks in a box with a total of 38 toy cars and toy trucks. How many toy trucks are in the box? Please explain. I hate this ratio

Respuesta :

Аноним Аноним
  • 03-01-2017
Let, the number of toy trucks = x
Then, number of toy cars = (x + 12)

Now, we have: x + x+12 = 38
2x + 12 = 38
2x = 38 - 12
2x = 26
x = 26/2
x = 13

So, there are 13 toy trucks in total.

Hope this helps!
Answer Link

Otras preguntas

2ln(5x)=8 solve for x
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
An archer’s arrow follows a parabolic path. The height of the arrow f(x) is given by f(x) = -16x^2 + 200x + 4, in feet. Find the maximum height of the arrow.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
What statement best describes a republic?
a antonym for biosphere
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
how can you write 0.45 as fraction and a percentage ,please show work