at0093591
at0093591 at0093591
  • 02-04-2021
  • Mathematics
contestada

hey i need some help​

hey i need some help class=

Respuesta :

jennifer29168 jennifer29168
  • 02-04-2021
don’t click the link it hacks you!!!
Answer Link

Otras preguntas

The process through which thoughts and actions become routine is ______.
Suppose Naomi gets a sales bonus at her place of work that gives her an extra $600 disposable income. She chooses to spend $360 and save the remaining $240. Fr
At a fast food restaurant, four friends each ordered a sandwich for $4.89 each and a drink for $1.69. What is the best estimate of the amount of change they wil
Katy invests a total of $26,500 in two accounts paying 4% and 9% annual interest, respectively. How much was invested in each account if, after one year, the to
the volume of a sphere is 2254 pi ^3 what is the surface area of the sphere
A sample of gas at 25ºc has a volume of 11 l and exerts a pressure of 660 mm hg. how many moles of gas are in the sample?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
True or false: martini di arma di taggia invented the martini in 1911 for john d. rockefeller at new york's hotel knickerbocker.
For the right triangle with side of lengths 5 12 and 13, find the length of the radius of the inscribed circle
3m2+7=55 answer please