oliviadumas7644 oliviadumas7644

01-03-2021
English

contestada

What are the coordinates of point B?A.(3, 11)B.(12, 2)C.(10, 1)D.(4, 6)

Respuesta :

0600911 0600911

01-03-2021

Answer:

D

Explanation:

Because the cordinates are B and A

Answer Link

Otras preguntas

Tell whether the ordered pair is a solution of the equation. y = x + 4; (2, 4)

What are the coordinates of point B on AC such that the ratio of AB to BC is 5 : 6

SOLVE PLEASE -2x^2+18x+____

In which landscape region would you most likely find intensely metamorphosed rock?

How can we tell when every point on the graph is a solution to the problem?

Process of Oxidation of NADH to NAD+ during aerobic respiration.

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

Hi thank you so for all your time and help in advance

3. A new Outdoor Recreation Center is being built in Del Rio. The perimeter of the rectangular playing field is 374 yards. Thelength of the field is 5 yards les

Helpppppp plas I don’t know the answer and I’m crying