priscillahamamoto priscillahamamoto
  • 03-02-2021
  • Health
contestada

What is it called when we hit the net on the serve and the ball lands in the
correct service box for tennis? *
1

Respuesta :

ang832 ang832
  • 03-02-2021
If the ball hits the net on the serve but then goes into the proper service box, it is called a Let
Answer Link

Otras preguntas

a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
Susan ........ (Run) to school because she was late.
Solve the equation -10 + 3x + 5x = -56 ? ??
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3
What is the additive inverse of -4a