hara123456789 hara123456789

05-09-2019
Social Studies

contestada

What is the money people use in a country calleda
A. trade
B. currency
C. exchange
D. volunt

Respuesta :

Gracieray Gracieray

05-09-2019

Answer:

B. Currency

Explanation:

Currency is money. It can vary in the types like ero in europe, dollars in america, and yen in japan.

Answer Link

Otras preguntas

PLEASE HELP!! What was the 90-day wage and price freeze? A) a temporary freeze on wages, prices, and rents B) a sale to help the economy C) a

The striton family had a meal catered for a wedding rehearsal dinner. The cost of the dinner was $476. There was a 5% sales tax and they left a 15% tip. What wa

Which of these describes an endothermic process? When lithium is placed in water, the temperature of the container increases. The combustion of kerosene re

When you prepare to make a left turn from a one-way road into a two-way road, you must:?

Solve all the solutions of sinsquarex - cossquarex = 0 in the interval 0,2pi

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

difference between syntax and semantics

The culture of children strongly approves of children tattling on one and other. a. True b. False

PLEASE HELP ASAP what is the correct product of (7x - 3)(7x + 3).49x^2 + 949x^2 - 42x + 9 49x^2 - 949x^2 + 42x + 9

need help anybody know how to do this