madams7201 madams7201

04-09-2018
Computers and Technology

contestada

With dhcp, a device borrows, or ____ an ip address while it is attached to the network.

Respuesta :

hancesoome hancesoome

08-09-2018

I guess the correct answer is leases.

With DHCP, a device borrows, or leases an IP address while it is attached to the network.

Answer Link

Otras preguntas

There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t

A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

Solve the equation -10 + 3x + 5x = -56 ? ??

A generator stores electric current. Explain why you agree or disagree with this statement

This natural landmark was created by the natural forces of erosion. What is its correct name and location?

what was paul revere failures

Which body tissue or organ contains the most mitochondria?

Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before

The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers