minnieguyton674 minnieguyton674
  • 04-06-2018
  • Social Studies
contestada

Cities in the Middle East are located near what natural resource ?

Respuesta :

Marietaylor2 Marietaylor2
  • 04-06-2018
I would choose trees
Answer Link

Otras preguntas

In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
What property is shown by the equation? 1. 0 ÷ (–6) = 0
What was George Washington's nickname?